Nady Nikonova :: Projects

   
  Back

Design By Sequence

     

Title: Horror DNA
Medium and Dimensions: Inkjet print on paper, plastic, and audio CD. Two 13 feet by 5.5 inches paper strands on a manikin hand; synthesized music using the sequenced DNA base pairs.

Base Pair Legend: 1) A = Frank, C = Columbia, G = Rocky, T = Janet. 2) A = A, C = C, G = G, T = F (musical notes).

     
     
 
     
     
 
     
 
     
     

Statement:

Can you tell which DNA sequence is the “normal” one and which is the mutated? Mutations arise spontaneously at a very slow rate and mostly occur in the introns, or “junk” DNA. It is notably rare for a mutation to occur in the coding region (exons) of an organism’s DNA. And if that does occur, there are mechanisms that reduce the chances of it becoming a problem. For example, there are 64 different combinations that an amino acid can take on, but only 20 amino acids, so that mistakes can be accounted for and more than one combination will still have the same result. Also, during DNA replication, the mechanism tries to “fix” certain mistakes that arise due to factors like mutations.
Knowing all of this, I looked around and asked myself, “What’s all the fuss about mutations?” There are movies and cartoons that thrive on the power of mutations to change an individual. Teenage Mutant Ninja Turtles and X-Men are examples of this mutant craze. They both feature good and evil characters that have been mutated to possess out of the ordinary powers. Moreover, deleterious mutations are focused on by the scientific society that is frantically searching for ways to “fix” them. So, the fuss is about the possibility of the next level of human evolution and to be able to fix harmful mutations … and, in my opinion, that is a logical way of thinking.

Accordingly, all the excitement about mutations spread to artists. Many artistes create genomic works of art that represent DNA and its relevance to us. Many feature works that play upon the differences of normal and mutated DNA. These differences are exaggerated because of their perceived effects. Normal DNA is created to look heavenly, while mutated DNA looks very different and, much of the time, darker. Even when my classmates and I were sharing ideas on how to represent two sequences of DNA, most of them saw fit to make the mutated DNA “funky” and “unusual.”

I have a different view. I do not believe that looking the reverse of the norm should represent mutated DNA. We already learned that mutations are rare, many go unnoticed, and there are mechanisms in the body that try to account for them. Furthermore, real-life mutations do not considerably change the shape or appearance of DNA. They simply change, delete, invert or substitute certain base pairs. Thus, I do not consider “normal” DNA and mutated DNA to be visually divergent. This thought influenced my art work.

The work consists of two media: visual and audio. In the visual piece, I reconstructed 100 base pairs of an Ammonifex Degensii sequence – one “normal” and one mutated. I represented the base pairs with pictures of Rocky Horror Picture Show characters. This is symbolic (well, in my mind because I’m such a fan) because these characters were open minded and learned to accept all types of diversity. So, if mutations occur at random, the sequence still looks “right” because all of the characters do each other in the movie. My mutated DNA included point mutations, deletions, and insertions. It is highly unlikely that all three will occur in one line of 100 bases, but because the sequences still look the same and are equally aesthetically pleasing, I show that the societal connotations of mutations should not influence how they are portrayed.

The second aspect of my piece is an audio component that enables the viewer to hear the sequences that they see through molecular music that I synthesized on the computer. The two melodies sounded very alike, actually, too alike. I had to struggle to make the two sound unalike by adding different background melodies, changing the tempos, and changing musical instruments. It is apparent to the listener that the two sequences sound very different only due to these changes and not the actual mutations.

Working with a specified sequence was both restrictive and moving. It was restrictive mainly because the proportions of the visual component got much longer than I wanted in the first place, it too long to make, and the molecular music (no matter how much I tried to liven it up) sounds boring. Then again, the long visual component really inspired me. It turned my conceptual knowledge of DNA length into a physical form that I related to, and thus really enabled me to envision, for the first time, this massive quantity. The size evokes a feeling of awe, and is a truly cool thing to look at.

The work was constructed in two different media. For the visual piece, I took photographs of Rocky Horror Picture Show dolls, scanned them, edited them, and finally printed them with a 1 inch length dimension. I also took a picture of a C&H sugar pack to represent the sugar and a yellow rubber ball with a “P” to symbolize a phosphate. I attached all of these pieces with tape in the way that unraveled DNA looks. I then built the complementary strand using the DNA base pairing rules and attached the two strands with a red ribbon. For the audio component, I assigned a note for each of the bases and created molecular music on Sonar. To make the two melodies differ, I deliberately changed the tempo, instruments, and accompaniments.

 

Original Sequence:

ATTACCCAAGCTATTTAGGTGACACTA
TAGAATACTCAAGCTATGCTCAAGCT
TGGTACCGAGCTCGATCCACTAGTAA
CCGCCAGTGTGCTGGAATTGC

 

Mutated Sequence:

ATTACCCAAGCTATTTAGGTGACAGTAT
AGAATACTCCCCCTATGCTCAAGCT
TGGTACCGAGCTCGATCCACTAGTAAC
CGCCAGTGTGCTGGAATTGCTTAGCT

     

Genetic Art Proposal

 

   
Title:     
     
Summary: