Niva Patel :: Projects

   
  Back

Design By Sequence

Title: Culture and Identity
Medium and Dimensions: 38.5 in x 18 in
     
 
     
 
     
     

Statement:

Nitrogenous bases make up DNA. DNA makes up genes. And our genes make our body. However, are our genes all we are? This question was my motivation for this project. Our genes control a lot in the way we look but does the way we look make up who we are? When I thought of who I was I thought of my culture. I’m Indian and being Indian is a big part of who I am. So when people say that your genes are who you are, I think that they are wrong. I think that genes are a part of who I am but I think that there are many other things that contribute to the person that I am today. When I started this project I wasn’t sure how I would integrate these two ideas of nature vs. nurture. I felt that though my genes made my physical body, my mind and personality was made by my upbringing. I had taken art classes before and my focus had been in portraiture so I decided to use this skill in this project. I took a picture of my mother on her wedding day and made a painting of it first. I then made two copies of it. I cut both copies into 100 rectangles. For one of the portraits I used a segment of the Ammonifex Degensii DNA, each rectangle being a base. I translated each base into Hindi letters, representing my culture. I then pasted the painting back together on a piece of cardboard. For the “mutated” sequence I mixed up the rectangles with the bases on them and then put them together in a random order. I wanted the “mutates” sequence to show that even if there are mutations in our DNA causing differences in our physical appearance we are still the same. With the paintings even though the “original” and the “mutated” do not look the same, they are the exact same painting. I think that the outcome of my project does relay my original message. Using DNA to inspire my artwork was a very different experience for me. I think that this project was interesting because it gives my perspective on a new discovery and also on my identity.

 

Original Sequence:

ATATTGGGATCGGCTAGCGCCCG
CTGGTCGTTGATGAGGTGCGCTC
CACGCCGCAGGCTTCCTCAGCCAC
CACTGCTTTGGAGGTATCGATGGAGATGGG

 

Mutated Sequence:

ACCTAAGGCCGTCCGGGATTAGTT
CGTTGCATTGGGCGCCCCGATGG
GACCTCGGAGACGTGCGGACTGC
CGGTCGGCGTTAGCTAGTAGCA
TACTTCTG

 
     
     
     

Genetic Art Proposal

 

   
Title:     
     
Summary: