Loren Sitomer :: Projects

   
  Back

Design By Sequence

     

Title: The Human, Genetic Mosaic
Medium and Dimensions: 12 inch wooden figure, multi-color stones (smooth and jagged)

Legend
Normal Sequence
C- blue triangle
G- red square
A- green square
T- orange square

Mutated Sequence
C- clear jagged stone
G- red jagged stone
A- green/yellow jagged stone
T- blue jagged stone

     
 
     
 
     
 
   
 
     

Statement:

For my genetic artwork, I explored the idea of the mosaic and how it relates to DNA. When I think of a mosaic, I think of different colors and shapes being combined to create a beautiful picture. The raw materials alone, stones and glue, do not have any type of meaning or aesthetic value. But it is when the stones are placed together to create some sort of pattern do we consider it to be art. I tried to relate this idea to DNA and how it shapes who and what we are. Chemical bases are meaningless unless they are placed together in a certain arrangement, or pattern, to create the blue-print of life. I wanted to create a genetic mosaic because in reality we are all mosaics. We all have internal and external differences partly because of the differences in each of our DNA.

To construct my project, I used two wooden figures, one containing the normal strand and one containing the mutated one. I pasted different colored stones, each representing a different base, on each of the figures. I thought of the wooden figures as representing human beings, which I think can be considered a canvas for an artist, DNA. DNA is an artist because it contains the blue-print for the human form, just as an artist has the form and ideas for his/her artwork.

For the mutated sequence, I used jagged stones instead of the smooth stones I used for the normal sequence. I did this because there are no two jagged stones that are exactly the same, just as in real life there are no two people that are exactly the same. Since mutations are very common in our DNA, I wanted the mutated strand to reflect real life. The normal sequence is not true of real life DNA because it contains no mutations. That is why the normal sequence is made of stones which are identical to each other (except their color). I also glued the mutated sequence’s bases in such a way that it resembles the helix of a strand of DNA. I did this because I wanted the mutated strand to resemble DNA more than the normal strand, since the mutated strand is more like real life DNA.

In conclusion, I think that using a real DNA sequence is an interesting way to create art. That is because the genetic code makes us who we are and even gives us the artistic capability to create art. The genetic code and art seem to go hand in hand because we wouldn’t be able to create art without the ability to move our bodies, something that is coded for in our DNA. I found the idea of working with a mosaic to be interesting because there are many symbols and ideas that go along with mosaics. I tried to relate those ideas to DNA and create a project that is not only aesthetic but also imaginative and original.

 

Original Sequence:

MCDBS03_04_Samp_05_700 5,10-methylene tetrahydrofolate dehydrogenase

GCCAAGCTATTTAGGTGACACTATAGA
ATACTCAAGCTATGCATCAAGCTTGGT
ACCGAGCTCGGATCCMCTAGTAACGA
AGCCAGTGTGCTGGAATTCCGCCC

 

Mutated Sequence:

GCCCAGTTATTTAGGAGGTGACATT
ATGAATCCCCAAAGGTATGTACACG
GTTGGTACCGAGCTCGGATTGMCGM
CTAGTAACGAAAAGCCCGTGTGTTG
GAATTTCCCGACGTCCC

 
     
     
     

Genetic Art Proposal

 

   
Title:     
     
Summary: