| Statement:
Over the past days, I can’t
count the number of times people walked past my workbench and asked,
“What is that?”
Each time, I took a few minutes to explain
the project and the class, and their confusion soon changed into
understanding, then into fascination. Those with free time often
examined closer, as though trying to peer into the genetic soup
and find my sequence. One asked if they could look at the sequence
itself, then tried to follow my thought pattern that had led to
the construction of a bamboo bridge. I wished that gentleman good
luck, but the lucky viewer will get a cheat sheet direct from the
source.
I wanted to go two directions with this
project; the primitive past, and the complex future. My original
plan was to forge a similar sculpture out of metal, but I found
the cost prohibiting. Instead, I focused on a very basic, very primitive
look. Our genes controlled our developmental past and regulate our
present. They do not however, dictate our future. When you are walking
across a bridge, you path is limited to what’s ahead and what’s
behind. You don’t have a choice of branching out in different
directions. The choice comes once you get off the bridge, once you
have crossed the divide. In a similar fashion, once we get over
the idea that our genes control who we are and what we do, I believe
that our world will open up once again. But a bridge is not a one
way path. At any time, should we choose, we could find ourselves
on the bridge once again.
A Bridge to the Past, A Path to the Future
has a simple key to understanding. The leaves spiral around the
pole as they climb upwards, as the DNA chain spirals around itself.
Each cluster of leaves represents a base from the Ammonifex degensii
genome. An A is four leaves, a G is three, a C is two, and the lonely
T receives one leaf. Mutations occur in the second half of the bridge,
and while some are visible in normal light, many cannot be identified
without the help of a black light. I wanted some of the mutations
to be hidden, showing that to the observer, there is nothing wrong
with the sequence until a test is applied. As part of my mutations,
four bases were dropped from the sequence, and rest beneath the
main pole as though they had fallen off the bridge. |
| Mutated
Sequence:
And finally, the mutated sequence as it appears on the bridge:
ATAGACCAATATTTTCTATTCTAA
----GTGCCGCTCGTATGCATTCGC
The variations are subtle, but include single
point mutations, reversals, and dropped bases. While to us, the
letters look random whether mutated or “normal,” they
appear as logical as arithmetic to our cells. Never forget though,
the mind controls the body. The self is more important than the
cell. |
