David Lee :: Projects

   
   
  Back
 

Design By Sequence

     
Title: Dolls, Dolls, and Dolls
Medium and Dimensions: 4” x 2.5” paper dolls
     
Images not available.    
   
     
   
     

Statement:

I had a rough start on this project considering I missed the opening discussion of project ideas. But I got around to getting some help and feedback from some peers and came up with a few ideas. I’m not a real artsy type person but the idea of doing something with paper dolls intrigued me with its simplicity and its potential to be visually appealing. Using genetic information to create a piece of art using this medium was more a decision of curiosity then a scholarly or artistic decision. My intention with this artwork was to in a simple way portray DNA by using a medium that DNA creates. The paper doll isn’t exactly a human being but that is the intention. Consider the 4 different dolls different ethnicities or perhaps different age groups; any statistical group could do. The original shows the random order of things in nature. The mutated version portrays a more utopian view where everything is nice and neat and how it’s “suppose to be.” Mainly it’s to try to have “humans” paired up the way they’re suppose to, male across from female in an orderly manner. In all its essence it probably really has nothing to do with the genetic sequence but that’s one view. The great thing about art is the ability for people to perceive it and analyze it in the way they want. From the most abstract and complicated pieces of work, to the downright most boring and plain ones. My project may seem simple but it’s my creation and something that I put time and effort into it. It’s art enough in its own right. Ok, enough defense on the behalf of my insecurities. Enjoy.

 

Original Sequence:

accatgattacgccaagcttgcatgcctgcaggtcgactc

 

Mutated Sequence:

aaaaggggaaaaggggaaaa

 
     
     
     

Genetic Art Proposal

 

   
Title:     
     
Summary: